|
Chlamydial Infection in Ornamental Birds
|
Daniel Kalateh Meimari1 , Mehdi Rezaei *2 , Mohammd Reza Asgharzadeh3  |
1- Doctor of Veterinary, Faculty of Veterinary Medicine, Urmia Branch, Islamic Azad University, Urmia, Iran. 2- Assistant Professor, Department of Clinical Sciences, Faculty of Veterinary Medicine, Urmia Branch, Islamic Azad University, Urmia, Iran. , mehdi217mr@yahoo.com 3- Assistant Professor, Department of Biology, Faculty of Basic Science, Urmia Branch, Islamic Azad University, Urmia, Iran. |
|
Keywords: Chlamydophila psittaci [MeSH], Birds [MeSH], Polymerase Chain Reaction [MeSH], Azure Stains [MeSH] Article ID: Vol27-28 |
|
|
Full-Text [PDF 685 kb]
(1813 Downloads)
| Abstract (HTML) (2335 Views)
|
|
Type of Study: Original Articles |
Subject:
Health System
|
|
|
|
|
|
|
Abstract: (247 Views) |
Extended Abstract
Introduction
Chlamydia are obligate intracellular coccobacillary Gram-negative bacteria, measuring 150 to 200 nanometers and approximately 200 to 300 nanometers in diameter as inclusion bodies, and are classified as energy parasites. Pathogenically, this bacterium belongs to the family Chlamydiaceae, which is currently classified into one genus, Chlamydia, and 11 species
Chlamydia trachomatis (C. trachomatis) was first described by Halberstadter and Von Prowazek in 1907 as an intracytoplasmic inclusion in conjunctival scrapings from a patient with trachoma. In humans, it is known as C. trachomatis, while in birds it is designated as Chlamydophila psittaci (C. psittaci). The disease agent in humans and psittaciformes is called psittacosis, and in other avian species, it is referred to as ornithosis. Chlamydiae replicate within the host cell in a unique biphasic developmental cycle. This cycle begins when the small, infectious, but metabolically inactive elementary body (EB), which is approximately 0.3μm in size, infects host epithelial cells. Upon entry into the cell, the EB transforms into the reticular body (RB)—a metabolically active, replicating, mesh-like body approximately 1μm in size—which then begins replication. The presence of intracytoplasmic inclusions in stained smears and histological sections is one of the most important characteristics of the disease.
C. psittaci is classified into 10 genotypes, A through G, E/B, M56, and WC, based on the outer membrane protein. Recent research has added two new genotypes, J and I, to this classification.
Chlamydiosis is considered a public health threat and a zoonotic agent capable of infecting humans. Consequently, veterinarians, avian zoo personnel, poultry slaughterhouse workers, poultry farm staff, and individuals involved in the purchase and sale of ornamental birds are at risk of exposure to this disease.
Given the zoonotic nature of the bacterium, disease symptoms in birds range from influenza-like syndrome to severe atypical pneumonia, including fever, anorexia, respiratory distress, dehydration, yellowish-green diarrhea, weight loss, conjunctivitis, rhinitis, and sinusitis. Some birds may not exhibit specific clinical signs and instead transmit the disease as asymptomatic carriers. Other factors contributing to the significance of this disease, beyond its transmissibility to humans, are the economic losses it incurs.
The transmission of C. psittaci occurs primarily from an infected bird to other birds in its vicinity. The causative agent is present in the respiratory secretions (inhalation of aerosols containing bacterial exudates) and digestive excretions (feces) of carrier birds, primarily activated by nutritional deficiencies, prolonged transport, cold, reproduction, and active egg-laying. Contamination can also take place through shared wet water or soil habitats with wild waterfowl, inhalation of dust from grain storage and sheds contaminated with feces, and transmission from parents to young birds during feeding.
While only limited studies have been conducted on Chlamydia infection in ornamental birds, there is a lack of sufficient data in Urmia, particularly due to the importation of these birds into the country. Moreover, given the increase in the ornamental bird population in recent years and the close contact between these birds and their owners, this situation could play a major role in the transmission of the infection to these at-risk individuals. Therefore, this study was conducted to determine the prevalence of Chlamydia in ornamental birds in Urmia, Iran.
Methods
This descriptive study was conducted on 60 cloacal swabs collected from 60 ornamental birds in Urmia, Iran, during the first quarter of 2024. The collected fecal swab samples were placed in phosphate-buffered saline (PBS). Giemsa staining was performed on the samples. Subsequently, chlamydial inclusion bodies were examined using light microscopy. DNA extraction was carried out using the phenol-chloroform method.
The primer sequences, ompA-F: CAAACTCATCAGACGAG and ompA-R: CTTCTTTAAGAGGTTTTACCC, were utilized to amplify a 580 base pair (bp) fragment within the genomic region of the ompA gene.
To perform the polymerase chain reaction (PCR), the master mix for all tested samples was calculated and prepared in a final volume of 25 μL, consisting of 5 μL of extracted DNA, 1 μL of forward primer, 1 μL of reverse primer, 12.5 μL of Master Mix, and 5.5 μL of water. The thermal cycle program was executed using a thermocycler.
Subsequently, the PCR products were analyzed on a 1% agarose gel in tris-borate-ethylenediaminetetraacetic acid (EDTA) (TBE) buffer, stained with safe stain (Sinaclon), and visualized using a UV illuminator.
Results
Results from the Giemsa staining test on the samples demonstrated that out of 17 prepared slides from the budgerigar species, 2 cases (11.7%) exhibited gastrointestinal signs and were positive for Chlamydia. The rates were determined to be 11.11% for the cockatiel species, 14.28% for the mynah species, 13.33% for the canary species, and 11.11% for the finch species. However, no positive cases were found in the African grey parrot and Agapornis roseicollis species.
In the PCR method, the results of amplifying the 580 bp fragment of the ompA gene on a 1% agarose gel indicated that, out of 17 samples collected from budgerigar species, 2 cases (11.7%) with gastrointestinal symptoms were positive for Chlamydia and formed a distinct band. Meanwhile, one case (5.88%) in an apparently healthy bird was positive. The prevalence was observed at 11.11% in cockatiels, 14.28% in mynahs, 20% in canaries, and at 11.11% in finches. Additionally, one case (14.28%) in the mynah species without gastrointestinal symptoms was also positive.
Conclusion
According to the results of the present study in Urmia, among ornamental birds, budgerigars, cockatiels, mynahs, canaries, and finches showed the highest prevalence of Chlamydia infection.
In the recent study, in addition to staining of fecal swab samples, the PCR molecular test was utilized. This high-accuracy and high-sensitivity method was performed based on the identification of the ompA gene in the gastrointestinal samples of the ornamental birds.
Given the zoonotic nature of the disease, infected birds remain carriers for the rest of their lives. These birds can transmit the illness to other birds or to their owners. This factor plays a significant role in the threat posed to the health of bird owners.
All Chlamydia infection species are transmissible to humans and may present asymptomatic or in a subclinical form. In such cases, the intermittent shedding of the organism persists for a prolonged period. Due to the zoonotic nature of the disease and direct or indirect human contact with birds, this asymptomatic shedding can pose a significant public health threat to humans. Mahzounieh et al. reported that 8 out of 32 (25%) fecal samples collected from clinically asymptomatic psittaciformes in different regions of Iran were positive for C. psittaci. The variation in prevalence rates across different studies is attributable to various factors, including the number of samples collected, stress factors, such as breeding seasons, food sources, relocation, and temperature changes, as well as the status of clinical signs among the sampled birds.
A cautionary note regarding the generalizability of this study's results is the greater number of bacterial positive cases identified by PCR testing compared to those found via Giemsa staining; this discrepancy may be attributed to staining errors versus the superior accuracy and sensitivity of the PCR test.
Ethical Statement
This study was approved by the Research Ethics Committee of Islamic Azad University, Urmia Branch (IR.IAU.URMIA.REC.1403.145).
Conflicts of Interest
No conflict of interest.
Acknowledgments
This article has been extracted from the DVM dissertation of Mr. Daniel Kalateh Meimari. We would like to sincerely thank all the individuals who assisted us in the execution of this study.
Authors' Contributions
Daniel Kalateh Meimari (DVM): Project execution, Data collection, Drafting of the initial manuscript.
Mehdi Rezaei (DVS.c): Project administration and design, Project execution, Data analysis, Interpretation of the results, Drafting of the initial manuscript, Approval of the final manuscript.
Mohammd Reza Asgharzadeh (Ph.D): Data analysis, Interpretation of the results.
Key Message: Chlamydia bacterium was found in avian fecal samples collected from ornamental birds in Urmia, which could be considered a source of infection in gastrointestinal diseases.
|
|
| Send email to the article author |
|
|
|
|